Rosenberg Lab | Research

research

Phylogenetics

Phylogenetics is the study of the pattern of the tree of life, i.e., reconstructing the complete history of evolutionary relationships among living organisms. In our lab we both use phylogenetics as a tool for understanding the evolutionary history of specific groups of organisms or traits of interest, and study the process of reconstructing phylogeny itself in order to understand how assumptions and methods may bias or affect our ability to accurately reconstruct our evolutionary past.

Sequence Alignment

ACGTCACGTCTGGCTCGCCAGACG
ATGCATGGT–––GCACGCACTCTG
ATATC––GGTCTGGGTCGCAGACTG
ACATC––GGTATGGCTCGCAGTCTG

Sequence alignment is a fundamental piece of comparative genomics and bioinformatics, yet the degree and effects of alignment error on downstream analysis has been woefully understudied. We use sequence simulation as a research paradigm for examining both the accuracy of alignment methodologies and the effects of inaccurate alignments on other bioinformatic and comparative genomic methodologies, including both phylogenetic and ancestral sequence reconstruction.